rnacanvas.embedded

Embed RNAcanvas in a webpage

View the Project on GitHub pzhaojohnson/rnacanvas.embedded

Here’s a live example on CodePen.

Quickstart

The RNAcanvas app object constructor can be loaded using a <script> element.

<script id="RNAcanvas" type="module" >
  import 'https://cdn.jsdelivr.net/npm/@rnacanvas/embedded@3.1.0';
</script>

This will inject the RNAcanvas app object constructor into the global scope.

Downstream code must wait for the script to load before using the RNAcanvas app object constructor.

Things like jQuery’s .ready() method can accomplish this.

$('#RNAcanvas').ready(() => {
  // RNA drawing code here...
});

Alternatively, the RNAcanvas app object constructor can be imported from an npm package (see section below).

Drawing a structure

// create a new RNAcanvas app instance
var rnaCanvas = new RNAcanvas();

// the RNAcanvas app must be added to the document body
// before drawing anything (see note below)
rnaCanvas.appendTo(document.body);

// control the size of the RNAcanvas app component
rnaCanvas.domNode.style.width = '1000px';
rnaCanvas.domNode.style.height = '750px';

// the structure to draw (using dot-bracket notation)
var seq = 'AGAGUAGCAUUCUGCUUUAGACUGUUAACUUUAUGAACCACGCGUGUCACGUGGGGAGAGUUAACAGCGCCC';
var dotBracket = '(((((((....)))))))...(((((((((((.....(((((.......)))))..))))))))))).....';

rnaCanvas.drawDotBracket(seq, dotBracket);

// make the drawing big enough to fit the drawn structure
// (and include some extra space around the drawn structure)
rnaCanvas.drawing.setPadding(1000);

// bring the drawn structure into view
rnaCanvas.drawingView.fitToContent();

The RNAcanvas app must be added to the document body of a webpage for its RNA drawing functionality to work properly.

(This is an inherent aspect of SVG drawing functionality in general for web browsers.)

The RNAcanvas app can be added to any container node present in the document body (not just the document body itself as shown in the example above).

npm installation

npm install @rnacanvas/app-object

The RNAcanvas app object constructor can be accessed as a named import.

import { RNAcanvas } from '@rnacanvas/app-object';

Further documentation

See the full documentation for the RNAcanvas app object.